Products
Replication-competent Virus Quantitation
SHENTEK® rcAAV Quantitation Kit is suitable for qPCR detection of replication-competent adeno-associated virus (rcAAV) from cell culture harvested bulk and purified stock. This rcAAV-5/N Quantitation Kit is designed for the quantification of rcAAV-5/N contamination in serotypes of rAAV-5/N (N stands for possible different capsid serotypes). The sample types include but are not limited to recombinant adeno-associated virus (rAAV) bulk and end-products, as well as harvested samples from cell culture desired for rcAAV detection.
Key information before using this kit:
1. AAV serotypes
2. The inverted terminal repeat (ITR) sequence of the test sample rAAV need to match the following sequences:
ITR sequence of rAAV-5/N
CTCTCCCCCCTGTCGCGTTCGCTCGCTCGCTGGCTCGTTTGGGGGGGTGG
CAGCTCAAAGAGCTGCCAGACGACGGCCCTCTGGCCGTCGCCCCCCCAA
ACGAGCCAGCGAGCGAGCGAACGCGACAGGGGGGAGAGTGCCACACTC
TCAAGCAAGGGGGT
